The T-DNA locus of N.benthamiana 16c



map mGFP5-ER sequence Tn5393 sequence Whole insert sequence in 16c GFP-ER transcript in 16c

Insertion point of T-DNA on Chr 7 on LAB genome assembly v3.3

Sequence Deleted from Genome at T-DNA insertion site in Chromosome 7

Download annotated whole insertion sequence (Geneious Format) Download annotated whole insertion sequence (Genbank Format)

The details of how the insertion sequence was obtained and verified are described in Philips et al 2017

Primer IDSequenceLocation
Primer A AGGAATATATGTTGGGTTTGAATC N. benthamiana flanking RB in 16c F2
Primer B AATTCTGGAAATATCAAAGGTG N. benthamiana flanking RB in 16c F1
Primer C GCTTAGCTCATTAAACTCCAGA NOS promoter R
Primer D CTCGGCCACAAGTTGGAATA Internal primer for mGFP5-ER F
Primer E GGTCTTGAAGTTGGCTTTGATG Internal primer for mGFP5-ER R
Primer F CACTTGTGAGGGGAGAATATAA N. benthamiana flanking LB in 16c R